Methods

Summary

eDNA for Mesophotic Ecosystem

General eDNA Sampling

To target all biodiversity in the photic and mesophotic ecosystems using the eDNA method, we will collect water samples from several sampling sites, particularly Bunaken Marine Park, including Bunaken Island, Manado Tua Island, and Siladen Island. Samples will be taken in triplicate and will consist of 5 liters of water per replicate collected from 15–20 m as well as 150–200 m depth using a Niskin bottle.

Water Filtration 

Following the methods of Miya et al. (2015), we will isolate eDNA from the water samples using Sterivex ™ filters (Millipore®, SIGMA MILLIPORE). eDNA extractions will be performed using the DNeasy Blood & Tissue Kit (QIAGEN, Germany) following previous methods (Marwayana et al., 2021). 

eDNA Extraction/Isolation and Amplification

We will amplify the extracted eDNA molecules using the Multiplex PCR Kit (QIAGEN, Germany) and target the 12S mitochondrial gene, which will be specifically targeted in marine fish. Table 1 shows the detailed information for primer sets. 

Table 1. eDNA primer sets which will be used to target the mesophotic fish

DNA Marker	Primer Name (Forward)	5’ –  ……  – 3’	Primer Name (Reverse)	5’ –  ……  – 3’	Reference	Organism Target
12S	MiFish-U F	GTCGGTAAAACTCGTGCCAGC	MiFish-U R	CATAGTGGGGTATCTAATCCCAGTTTG	Miya et al., 2015	Fish
12S	12SF1/R1-For	ACTGGGATTAGATACCCC	12SF1/R1-Rev	TAGAACAGGCTCCTCTAG	Riaz et al., 2011	Fish

eDNA Purification and Quantification

PCR results will be visualized using gel electrophoresis and then purified using Sera-Mag ™ and Sera-Mag SpeedBeads Magnetic Particles (SIGMA-ALDRICH®). We will then pool the three PCR replicates and adjust the final library concentration after quantification using the Qubit ™ 4 NGS Starter Kit (ThermoFisher). 

Library Preparation for NGS Sequencing

We will then indiex the PCR libraries using the Nextera DNA Library Preparation Kit (illumine®) using a specific combination of the Illumina Nextera i5 and i7 primers in the second PCR process. The final PCR products will be sequenced at UCLA using the Illumina MiSeq platform. For the bioinformatic analysis, we will use the Anacapa pipeline with rCRUX for constructing a reference database (Curd et al., 2023) to analyze the eDNA signals.

Challenges

The main challenge that we may face is the lack of reference databases that contain the barcodes that could be used to assign mesophotic fish, given that little is known about fish that live in the mesophotic zone. In addition, some external factors, like strong deep marine currents and local weather, may disrupt the activities during field sampling.

Pre Analysis Plan

What we can prepare for the pre-analysis plan is we are going to use the most updated way to construct reference database via a pipeline in R, called rCRUX. CRUX stands for Creating Reference libraries Using eXisting tools. Once we are able to create good reference libraries to assign the eDNA sequences, remove the contaminants, and finally establish the taxonomy tables, we are going to continue the data analysis using some biodiversity indexes, like alpha, beta, and zeta diversity, to see the species richness, species abundance, and species structure. We will then make a comparison in terms of the diversity in the shallow-water ecosystem and the mesophotic ecosystem. As the outcome, we would come up with some diagrams that would explain whether (1) there are no overlapping species from each ecosystem, (2) there are some overlapping species (less than 50%), or (3) the overlapping species make up more than 50% of the total capture of eDNA signals, which means there are more similarities than diversity between the shallow water ecosystem and the mesophotic ecosystem.