eDNA for Mesophotic Ecosystem
General eDNA Sampling
To target all biodiversity in the photic and mesophotic ecosystems using the eDNA method, we will collect water samples from several sampling sites, particularly Bunaken Marine Park, including Bunaken Island, Manado Tua Island, and Siladen Island. Samples will be taken in triplicate and will consist of 5 liters of water per replicate collected from 15–120 m as well as 150–200 m depth using a Niskin bottle.
Water Filtration
Following the methods of Miya et al. (2015), we will isolate eDNA from the water samples using Sterivex ™ filters (Millipore®, SIGMA MILLIPORE). eDNA extractions will be performed using the DNeasy Blood & Tissue Kit (QIAGEN, Germany) following previous methods (Marwayana et al., 2021).
eDNA Extraction/Isolation and Amplification
We will amplify the extracted eDNA molecules using the Multiplex PCR Kit (QIAGEN, Germany) and target the 12S mitochondrial gene, which will be specifically targeted in marine fish. Table 1 shows the detailed information for primer sets.
Table 1. eDNA primer sets which will be used to target the mesophotic fish
DNA Marker | Primer Name (Forward) | 5’ – …… – 3’ | Primer Name (Reverse) | 5’ – …… – 3’ | Reference | Organism Target |
12S | MiFish-U F | GTCGGTAAAACTCGTGCCAGC | MiFish-U R | CATAGTGGGGTATCTAATCCCAGTTTG | Fish | |
12S | 12SF1/R1-For | ACTGGGATTAGATACCCC | 12SF1/R1-Rev | TAGAACAGGCTCCTCTAG | Riaz et al., 2011 | Fish |
eDNA Purification and Quantification
PCR results will be visualized using gel electrophoresis and then purified using Sera-Mag™ and Sera-Mag SpeedBeads Magnetic Particles (SIGMA-ALDRICH®), as well as QIAquick Gel Extraction Kit. We will then pool the three PCR replicates and adjust final library concentration after quantification using the Qubit ™ 4 NGS Starter Kit (ThermoFisher).
Library Preparation for NGS Sequencing
We will then indiex the PCR libraries using the Nextera DNA Library Preparation Kit (illumine®) using a specific combination of the Illumina Nextera i5 and i7 primers in the second PCR process. The final PCR products will be sequenced at UCLA using the Illumina MiSeq platform. For the bioinformatic analysis, we will use the Anacapa pipeline with rCRUX for constructing a reference database (Curd et al., 2023) to analyze the eDNA signals.
- Published on Mar 28, 2024
- 20 views
- 0 comments
- Print this page
- Back to Methods