Potential of the Rewa River oysters in enhancement of community livelihoods and resilience

Methods

Summary

Morphology and DNA barcoding

To clarify species identity, the morphology and DNA barcoding of adult oysters will be undertaken. After morphological and morphometric examination DNA barcoding of 35 samples of each morphologically distinct group will be conducted. Samples collected from the wild will be transported live to USP Marine School Laboratory to be identified morphologically using cladistics analysis described by littlewood (1994). The oyster shell morphometrics will be recorded after which the adductor muscle of each individual will be excised and preserved in molecular grade ethanol until DNA extraction. The total genomic DNA will be extracted from all specimens using a DNeasy® Tissue Kit (Qiagen). The mitochondrial COI genes will be subjected to polymerase chain reaction (PCR) amplification using Universal bivalve primers LCO1490 (forward primer, 5' GGTCAACAAATCATAAAGATA TTGG -3') and HCO2198 (reverse primer, 5'-TAAACTTCAGGGTGACC AAAAAATCA-3') as designed by Folmer et al. (1994). The amplification conditions for COI consist of initial denaturation at 94°С for 2.5 min; then 35 cycles of denaturation at 94°С for 30 s, annealing at 54°С for 1 min, extension at 72°С for 1 min; and final extension at 72°С for 10 min. The samples will then be sent with the primers either to Australia’s Genome Research Facilities (AGRF) or Macrogen (Korea) for the sequencing.

 Recruitment patterns

For assessment of seasonal recruitment patterns, Oyster spat will be collected on specially designed spat collectors made from PVC (Polyvinyl chloride) pipe (80 mm). Each collector will be made of 2x7 pages of 1.2 meter PVC separated from each other by an 80 mm pipe. The pages will be separated by 3x8 cross pieces of 400 mm PVC. The PVC pipes will be held in place using fencing wire. The experiment will be carried out for 14 months.  At the beginning of each month, three collectors will be deployed at predetermined collection sites around Laucala Bay at a depth suitable for optimal recruitment of oyster spat. Each collector will be fastened to a timber frame at several sites. Recovery of spat from collectors will be conducted every 30 days and each collector will be replaced with preconditioned, new collectors at each sampling period. The encrusting spats will be counted and provide spat density. Spat will also be measured at each collection period. For the identification of oyster species at the recruitment stage, genetic tests will be performed on the individuals fixed in the collectors, randomly selected by sampling. The procedure will be the same as for the adult oysters. After the spat are removed, the collectors will be scrubbed and reconditioned in sea water at the sea water lab at Marine Studies campus, USP. Environmental parameters pH, temperature (°C), salinity (ppt) and chlorophyll concentration will be monitored using data loggers fixed at the site.

Challenges

The two main risks associated with the project are natural disasters (cyclones) which could damage oyster spat collection infrastructure and data loggers, and Covid related lockdown of the country as experienced in 2020 and 2021. For natural disasters, infrastructure will be removed and kept safe and if the country is forced into Covid related lockdowns the spat recruitment monitoring process will be restarted.